Review



rabbit polyclonal  (Novus Biologicals)


Bioz Verified Symbol Novus Biologicals is a verified supplier
Bioz Manufacturer Symbol Novus Biologicals manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 94
      Buy from Supplier

    Structured Review

    Novus Biologicals rabbit polyclonal
    Antibodies used in western blot analysis
    Rabbit Polyclonal, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 94/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/synaptophysin+rabbit+polyclonal+antibody/Synaptophysin+Antibody+-+BSA+Free/pmc11801287-10-2-8
    Average 94 stars, based on 9 article reviews
    rabbit polyclonal - by Bioz Stars, 2026-09
    94/100 stars

    Images

    1) Product Images from "Small molecule inhibitor DDQ-treated hippocampal neuronal cells show improved neurite outgrowth and synaptic branching"

    Article Title: Small molecule inhibitor DDQ-treated hippocampal neuronal cells show improved neurite outgrowth and synaptic branching

    Journal: Neural Regeneration Research

    doi: 10.4103/NRR.NRR-D-24-00157

    Antibodies used in western blot analysis
    Figure Legend Snippet: Antibodies used in western blot analysis

    Techniques Used: Western Blot

    Antibodies used in immunofluorescence analysis
    Figure Legend Snippet: Antibodies used in immunofluorescence analysis

    Techniques Used: Immunofluorescence

    Related Articles

    other:

    Article Title: TEMPOL Enhances Polyethylene Glycol Axon Fusion Following Sciatic Nerve Transection in Adult Rats
    Article Snippet: Anti-Synaptophysin , Synaptic vesicles , Novus Biologicals , rabbit , NBP2-25170 , 1/1000.

    Article Title: Table 2
    Article Snippet: Synaptophysin , Novus Biologicals , Rabbit , NBP2–25170 , 1:1000.

    Article Title: Methods to induce terminal differentiation in stem cells by interfering with DNA replication, methods of inducing pancreatic differentiation, and differentiated cells obtained thereof
    Article Snippet: Gene Forward Reverse OCT4 TGGGCTCGAGAAGGATGTG GCATAGTCGCTGCTTGATCG (SEQ ID NO: 1) (SEQ ID NO: 2) SOX17 GGCGCAGCAGAATCCAGA CCACGACTTGCCCAGCAT (SEQ ID NO: 3) (SEQ ID NO: 4) FOXA2 GGGAGCGGTGAAGATGGA TCATGTTGCTCACGGAGGAGTA (SEQ ID NO: 5) (SEQ ID NO: 6) PDX1 CCCTGGGTGACCACTAAACC CACAGCCTCTACCTCGGAAC (SEQ ID NO: 7) (SEQ ID NO: 8) NKX6.1 ATTCGTTGGGGATGACAGAG CGAGTCCTGCTTCTTCTTGG (SEQ ID NO: 9) (SEQ ID NO: 10) NGN3 TCTTTTCTCCTTTGGGGCTGG TCTCACGGGTCACTTGGACA (SEQ ID NO: 11) (SEQ ID NO: 12) SUR1 GTTCCAGCAGAAGCTTCTCG GCTGAAATTCTCCCCGCCTT (SEQ ID NO: 13) (SEQ ID NO: 14) INS TTCTACACACCCAAGACCCG CAATGCCACGCTTCTGC (SEQ ID NO: 15) (SEQ ID NO: 16) GLU AAGTTCCCAAAGAGGGCTTG AGCTGCCTTGTACCAGCATT (SEQ ID NO: 17) (SEQ ID NO: 18) TABLE 4 Primary antibody list Catalog Antibody Species Dilution Company number SOX17 Goat 1:100 R&D Systems AF1924 FOXA2 Rabbit 1:400 Cell Signaling 3143S Technology PDX1 Goat 1:100 R&D Systems AF2419 NKX6.1 Mouse 1:300 Developmental F55A10 Studies Hybridoma Bank C-peptide Rat 1:100 Developmental GN-ID4 Studies Hybridoma Bank Glucagon Guinea Pig 1:200 Takara M182 MafA Rabbit 1:100 Abcam ab26405 Somatostatin Rabbit 1:1000 Millipore AB5494 Chromogranin Mouse 1:100 Millipore MAB5268 A Synaptophysin Rabbit 1:100 Novus NB300-653 Biologicals Ki67 Rabbit 1:200 Abcam ab16667 CK19 Rabbit 1:200 Abcam ab52625 TABLE 5 Secondary antibody list Catalog Antibody Dilution Company number Donkey Anti-Rat 1:500 Jackson 712-545-153 Alexa Fluor ® 488 ImmunoResearch Laboratories Donkey Anti-Rabbit 1:500 Jackson 711-475-152 DyLight TM 405 ImmunoResearch Laboratories Donkey Anti-Mouse 1:500 Jackson 715-475-151 DyLight TM 405 ImmunoResearch Laboratories Donkey Anti-Guinea 1:500 Jackson 706-605-148 Pig Alexa Fluor ® 647 ImmunoResearch Laboratories Donkey Anti-Rabbit 1:500 Life Technologies A-31572 Alexa Fluor ® 555 Donkey Anti-Goat 1:500 Life Technologies A-21432 Alexa Fluor ® 555 Donkey Anti-Mouse 1:500 Life Technologies A-21202 Alexa Fluor ® 488 Donkey Anti-Mouse 1:500 Life Technologies A-31570 Alexa Fluor ® 555 Donkey Anti-Goat 1:500 Life Technologies A-11055 Alexa Fluor ® 488 Donkey Anti-Rabbit 1:500 Life Technologies A-21206 Alexa Fluor ® 488 Goat Anti-Rat 1:500 Life Technologies A-21434 Alexa Fluor ® 555

    Incubation:

    Article Title: Combined Neuroprotective Effects of N,N-Dimethyltryptamine and Ventral Root Reimplantation Following Spinal Root Avulsion in Rats.
    Article Snippet: .. Sections were incubated overnight at 4°C with the following primary antibodies: rabbit anti- Iba1 (1:750, FUJIFILM Wako Pure Chemical Corporation Cat# 019- 19741, RRID:AB_839504); rabbit anti- GFAP (1:750; Abcam Cat# ab7260, RRID:AB_305808); rabbit anti- Synaptophysin (1:1000; Novus Cat# NBP2- 25170, RRID:AB_2814699). .. Following primary antibody incubation, sections were rinsed in 0.01 M PB (3× 5 min) and incubated with Alexa Fluor 488- conjugated secondary antibody (1:250, Jackson ImmunoResearch Labs Cat# 111- 545- 008, RRID: AB_2338048) for 1 h at room temperature.

    Article Title: Combined Neuroprotective Effects of N,N‐Dimethyltryptamine and Ventral Root Reimplantation Following Spinal Root Avulsion in Rats
    Article Snippet: .. Sections were incubated overnight at 4°C with the following primary antibodies: rabbit anti‐Iba1 (1:750, FUJIFILM Wako Pure Chemical Corporation Cat# 019‐19741, RRID:AB_839504); rabbit anti‐GFAP (1:750; Abcam Cat# ab7260, RRID:AB_305808); rabbit anti‐Synaptophysin (1:1000; Novus Cat# NBP2‐25170, RRID:AB_2814699). .. Following primary antibody incubation, sections were rinsed in 0.01 M PB (3× 5 min) and incubated with Alexa Fluor 488‐conjugated secondary antibody (1:250, Jackson ImmunoResearch Labs Cat# 111‐545‐008, RRID: AB_2338048) for 1 h at room temperature.



    Similar Products

    rabbit polyclonal anti synaptophysin antibody  (Proteintech)
    96
    Proteintech rabbit polyclonal anti synaptophysin antibody
    Rabbit Polyclonal Anti Synaptophysin Antibody, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/synaptophysin+rabbit+polyclonal+antibody/Synaptophysin+Antibody/pm41748571-276-50-56
    Average 96 stars, based on 1 article reviews
    rabbit polyclonal anti synaptophysin antibody - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier
    synaptophysin  (OriGene)
    94
    OriGene synaptophysin
    Histopathology and immunohistochemistry findings. Immunohistochemistry images for smooth muscle actin showing negative staining at (A) ×10 and (B) ×40 magnification. immunohistochemistry for INI-1 showing complete loss of nuclear expression (negative) at (C) ×10 and (D) ×40 magnification. Immunohistochemistry for Ki-67 demonstrating a markedly elevated proliferation index, reaching ~80% in the most active regions, at (E) ×10 and ×40 (F) magnification. Immunohistochemistry for <t>synaptophysin</t> showing negative staining at (G) ×10 and (H) ×40 magnification. Arrows indicate representative tumor areas of staining. All sections were obtained from the resected intracranial mass, and are formalin-fixed paraffin-embedded tissue, with hematoxylin counterstain. Scale bar, 100 µm.
    Synaptophysin, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/synaptophysin+rabbit+polyclonal+antibody/Synaptophysin+(SYP)+Rabbit+Polyclonal+Antibody/pmc12750061-94-110-114
    Average 94 stars, based on 1 article reviews
    synaptophysin - by Bioz Stars, 2026-09
    94/100 stars
    		  Buy from Supplier
    rabbit polyclonal  (Novus Biologicals)
    94
    Novus Biologicals rabbit polyclonal
    Antibodies used in western blot analysis
    Rabbit Polyclonal, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/synaptophysin+rabbit+polyclonal+antibody/Synaptophysin+Antibody+-+BSA+Free/pmc11801287-10-2-8
    Average 94 stars, based on 1 article reviews
    rabbit polyclonal - by Bioz Stars, 2026-09
    94/100 stars
    		  Buy from Supplier
    rabbit polyclonal anti synaptophysin  (Cell Signaling Technology Inc)
    96
    Cell Signaling Technology Inc rabbit polyclonal anti synaptophysin
    Antibodies used in western blot analysis
    Rabbit Polyclonal Anti Synaptophysin, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/synaptophysin+rabbit+polyclonal+antibody/Synaptophysin+Antibody/pmc12400595-70-103-115
    Average 96 stars, based on 1 article reviews
    rabbit polyclonal anti synaptophysin - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier
    rabbit polyclonal antibody syp  (Proteintech)
    96
    Proteintech rabbit polyclonal antibody syp
    Antibodies used in western blot analysis
    Rabbit Polyclonal Antibody Syp, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/synaptophysin+rabbit+polyclonal+antibody/Synaptophysin+Antibody/pm40555472-194-61-65
    Average 96 stars, based on 1 article reviews
    rabbit polyclonal antibody syp - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier
    synaptophysin (syp) rabbit polyclonal antibody  (Santa Cruz Biotechnology)
    90
    Santa Cruz Biotechnology synaptophysin (syp) rabbit polyclonal antibody
    Antibodies used in western blot analysis
    Synaptophysin (Syp) Rabbit Polyclonal Antibody, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/synaptophysin+rabbit+polyclonal+antibody/synaptophysin++syp+antibody/pm40533890-76-0-16
    Average 90 stars, based on 1 article reviews
    synaptophysin (syp) rabbit polyclonal antibody - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    rabbit polyclonal synaptophysin antibody  (Proteintech)
    96
    Proteintech rabbit polyclonal synaptophysin antibody
    Antibodies used in western blot analysis
    Rabbit Polyclonal Synaptophysin Antibody, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/synaptophysin+rabbit+polyclonal+antibody/Synaptophysin+Antibody/pm40025036-237-29-34
    Average 96 stars, based on 1 article reviews
    rabbit polyclonal synaptophysin antibody - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier

    Image Search Results


    Histopathology and immunohistochemistry findings. Immunohistochemistry images for smooth muscle actin showing negative staining at (A) ×10 and (B) ×40 magnification. immunohistochemistry for INI-1 showing complete loss of nuclear expression (negative) at (C) ×10 and (D) ×40 magnification. Immunohistochemistry for Ki-67 demonstrating a markedly elevated proliferation index, reaching ~80% in the most active regions, at (E) ×10 and ×40 (F) magnification. Immunohistochemistry for synaptophysin showing negative staining at (G) ×10 and (H) ×40 magnification. Arrows indicate representative tumor areas of staining. All sections were obtained from the resected intracranial mass, and are formalin-fixed paraffin-embedded tissue, with hematoxylin counterstain. Scale bar, 100 µm.

    Journal: Oncology Letters

    Article Title: Primary intracranial extraskeletal myxoid chondrosarcoma in a teenager with unusual frontal location and surgical complications: A case report and literature review

    doi: 10.3892/ol.2025.15437

    Figure Lengend Snippet: Histopathology and immunohistochemistry findings. Immunohistochemistry images for smooth muscle actin showing negative staining at (A) ×10 and (B) ×40 magnification. immunohistochemistry for INI-1 showing complete loss of nuclear expression (negative) at (C) ×10 and (D) ×40 magnification. Immunohistochemistry for Ki-67 demonstrating a markedly elevated proliferation index, reaching ~80% in the most active regions, at (E) ×10 and ×40 (F) magnification. Immunohistochemistry for synaptophysin showing negative staining at (G) ×10 and (H) ×40 magnification. Arrows indicate representative tumor areas of staining. All sections were obtained from the resected intracranial mass, and are formalin-fixed paraffin-embedded tissue, with hematoxylin counterstain. Scale bar, 100 µm.

    Article Snippet: The Roche BenchMark automated staining platform was used according to the manufacturer's instructions, with the following ready-to-use primary antibodies, incubated at room temperature for 32 min: p53 (cat. no. 61209507; Beijing Zhongshan Jinqiao Biotechnology Co., Ltd.), vimentin (cat. no. ZM-0260; Beijing Zhongshan Jinqiao Biotechnology Co., Ltd.), Ki-67 (Gene Tech Co., Ltd.; cat. no. GT209407 ), CK(Pan) (GeneTech Co., Ltd.; cat. no. GM351507 ), INI1 (Beijing Zhongshan Jinqiao Biotechnology Co., Ltd.; cat. no. ZA-0696), S100 (Beijing Zhongshan Jinqiao Biotechnology Co., Ltd.; cat. no. ZA-0225), Desmin (GeneTech Co., Ltd.; cat. no. GT225207 ), EMA (Thermo Fisher Scientific, Inc.; cat. no. 24 h-0095), GFAP (cat. no. ZM-0118; Beijing Zhongshan Jinqiao Biotechnology Co., Ltd.), synaptophysin (cat. no. ZM-0246; Beijing Zhongshan Jinqiao Biotechnology Co., Ltd.), CD34 (GeneTech Co., Ltd.; cat. no. GM716507), IDH1 (Beijing Zhongshan Jinqiao Biotechnology Co., Ltd.; cat. no. ZM-0447), SOX10 (cat. no. ZA-0624; Beijing Zhongshan Jinqiao Biotechnology Co., Ltd.), STAT6 (cat. no. ZA-0647; Beijing Zhongshan Jinqiao Biotechnology Co., Ltd.), NKX2.2 (cat. no. ZA-0655; Beijing Zhongshan Jinqiao Biotechnology Co., Ltd.) and SMA (cat. no. Kit-0006/MAB-0890; Abcam).

    Techniques: Histopathology, Immunohistochemistry, Negative Staining, Expressing, Staining, Formalin-fixed Paraffin-Embedded

    Antibodies used in western blot analysis

    Journal: Neural Regeneration Research

    Article Title: Small molecule inhibitor DDQ-treated hippocampal neuronal cells show improved neurite outgrowth and synaptic branching

    doi: 10.4103/NRR.NRR-D-24-00157

    Figure Lengend Snippet: Antibodies used in western blot analysis

    Article Snippet: Synaptophysin , Rabbit polyclonal 1:50 , NBP2-25170 , Novus Biologicals , , Anti-rabbit Dylight 488 1:500 , 35552 , Thermo Fisher Scientific.

    Techniques: Western Blot

    Antibodies used in immunofluorescence analysis

    Journal: Neural Regeneration Research

    Article Title: Small molecule inhibitor DDQ-treated hippocampal neuronal cells show improved neurite outgrowth and synaptic branching

    doi: 10.4103/NRR.NRR-D-24-00157

    Figure Lengend Snippet: Antibodies used in immunofluorescence analysis

    Article Snippet: Synaptophysin , Rabbit polyclonal 1:50 , NBP2-25170 , Novus Biologicals , , Anti-rabbit Dylight 488 1:500 , 35552 , Thermo Fisher Scientific.

    Techniques: Immunofluorescence